Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

bbCas9pluspAAA
(Plasmid #82581)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 82581 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pUC
  • Backbone size w/o insert (bp) 1932
  • Total vector size (bp) 6397
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cas9
  • Alt name
    humanized Cas9
  • Species
    S. pyogenes
  • Promoter T7

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CTGCGTTATCCCCTGATTCTGTGG
  • 3′ sequencing primer GGGCGACACGGAAATGTTGAATAC
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry

Depositor Comments

Cas9 insert is cloned from pX330 Addgene #42230

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    bbCas9pluspAAA was a gift from Ivo Huijbers (Addgene plasmid # 82581 ; http://n2t.net/addgene:82581 ; RRID:Addgene_82581)
  • For your References section:

    Direct Generation of Conditional Alleles Using CRISPR/Cas9 in Mouse Zygotes. Pritchard CEJ, Kroese LJ, Huijbers IJ. Methods Mol Biol. 2017;1642:21-35. doi: 10.1007/978-1-4939-7169-5_2. 10.1007/978-1-4939-7169-5_2 PubMed 28815491