bbCas9pluspAAA
(Plasmid
#82581)
-
PurposeThe plasmid encodes the T7 promoter, Cas9 (from pX330 #42230) and a stretch of poly-A. After linearization with restriction enzyme SapI It is used to produce in vitro transcribed mRNA
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 82581 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepUC
- Backbone size w/o insert (bp) 1932
- Total vector size (bp) 6397
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCas9
-
Alt namehumanized Cas9
-
SpeciesS. pyogenes
- Promoter T7
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CTGCGTTATCCCCTGATTCTGTGG
- 3′ sequencing primer GGGCGACACGGAAATGTTGAATAC (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Cas9 insert is cloned from pX330 Addgene #42230
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
bbCas9pluspAAA was a gift from Ivo Huijbers (Addgene plasmid # 82581 ; http://n2t.net/addgene:82581 ; RRID:Addgene_82581) -
For your References section:
Direct Generation of Conditional Alleles Using CRISPR/Cas9 in Mouse Zygotes. Pritchard CEJ, Kroese LJ, Huijbers IJ. Methods Mol Biol. 2017;1642:21-35. doi: 10.1007/978-1-4939-7169-5_2. 10.1007/978-1-4939-7169-5_2 PubMed 28815491