p204_LTJ_sgRNACD45.2_R2
(Plasmid
#82673)
-
PurposesgRNA targeting murine CD45.2 region 2. Co-expresses SpCas9-2A-EGFP.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 82673 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepX458
-
Backbone manufacturerFeng Zhang (Addgene plasmid# 48138)
- Backbone size w/o insert (bp) 9300
- Total vector size (bp) 9300
-
Modifications to backbonesgRNA cloned into the BbsI site of pX458
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersEGFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA targeting CD45.2 region 2
-
gRNA/shRNA sequenceGCAGACTCAGGTTTAGATAC
-
SpeciesM. musculus (mouse)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer U6-forward primer (ACTATCATATGCTTACCGTAAC) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Plasmid co-expresses Cas9 from S. pyogenes with 2A-EGFP, as part of the pX458 backbone. These plasmids were previously associated with the following preprint: Highly efficient and versatile plasmid-based gene editing in primary T cells bioRxiv. 13 January 2018. doi:10.1101/247544
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p204_LTJ_sgRNACD45.2_R2 was a gift from Lukas Jeker (Addgene plasmid # 82673 ; http://n2t.net/addgene:82673 ; RRID:Addgene_82673) -
For your References section:
Highly Efficient and Versatile Plasmid-Based Gene Editing in Primary T Cells. Kornete M, Marone R, Jeker LT. J Immunol. 2018 Feb 14. pii: jimmunol.1701121. doi: 10.4049/jimmunol.1701121. 10.4049/jimmunol.1701121 PubMed 29445007