Skip to main content

pSELECT-HA-mFOXO1
(Plasmid #83308)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 83308 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSELECT-puro
  • Backbone manufacturer
    Invivogen
  • Backbone size w/o insert (bp) 3390
  • Total vector size (bp) 5432
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    None
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Puromycin (100-150ug/mL) can be used for selection in E. coli
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    FoxO1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1983
  • GenBank ID
    NM_ 019739.3
  • Entrez Gene
    Foxo1 (a.k.a. Afxh, FKHR, Fkhr1, Foxo1a)
  • Promoter hEF1/HTLV prom
  • Tag / Fusion Protein
    • HA (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer GACCCTGCTTGCTCAACTCT
  • 3′ sequencing primer GTCTACGCTGCCCAGTCTGT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    pCMV5-HA-FOXO1 containing mouse FOXO1 ORF fused to HA-tag was obtained from AddGene (plasmid 12142) originally constructed by Nakae and coworkers (JCI 108:1359, 2001
  • Article Citing this Plasmid

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

To construct pSELECT-HA-mFOXO1 the coding sequence of HA tag and FOXO1 were amplified from pCMV-HA-FOXO1 by PCR. The PCR product was digested with NheI and SalI restriction enzymes and inserted into the NheI and SalI sites of pSELECT-puro.
The insert was sequenced and compared to mouse FOXO1 (NM_019739.3). Sequence identity was confirmed except for a conservative A->G mutation at base 474, a non-conservative A->G mutation at base 1121 and a non-conservative mutation T->C mutation at base 2321 of NM_019739.3. These mutations were confirmed to exist in the original pCMV-HA-FOXO1 plasmid. The non-conservative mutations result in a K->R substitution at amino acid 219 and a L->P substitution at amino acid 619 of mFOXO1 (NP_062713.2).
Mutations at bases 1121 and 2321 were reversed to wild type by site-directed mutagenesis and the corrections were confirmed by sequencing

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSELECT-HA-mFOXO1 was a gift from Steven Abcouwer (Addgene plasmid # 83308 ; http://n2t.net/addgene:83308 ; RRID:Addgene_83308)
  • For your References section:

    Insulin-like growth factor 1 rescues R28 retinal neurons from apoptotic death through ERK-mediated BimEL phosphorylation independent of Akt. Kong D, Gong L, Arnold E, Shanmugam S, Fort PE, Gardner TW, Abcouwer SF. Exp Eye Res. 2016 Aug 7;151:82-95. doi: 10.1016/j.exer.2016.08.002. 10.1016/j.exer.2016.08.002 PubMed 27511131