T-STOP sgRNA-1
(Plasmid
#83346)
-
PurposeThe sgRNA at the stop codon of human Brachyury(T) locus
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 83346 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCR-Blunt II-TOPO
-
Backbone manufacturerThermofisher
- Backbone size w/o insert (bp) 3519
- Total vector size (bp) 3974
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameT-STOP sgRNA
-
gRNA/shRNA sequenceGCCTTCCATGTGAAGCAGCA
-
SpeciesH. sapiens (human)
- Promoter U6
Cloning Information
- Cloning method TOPO Cloning
- 5′ sequencing primer M13R
- 3′ sequencing primer M13F (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
T-STOP sgRNA-1 was a gift from James Thomson (Addgene plasmid # 83346 ; http://n2t.net/addgene:83346 ; RRID:Addgene_83346) -
For your References section:
Single-cell RNA-seq reveals novel regulators of human embryonic stem cell differentiation to definitive endoderm. Chu LF, Leng N, Zhang J, Hou Z, Mamott D, Vereide DT, Choi J, Kendziorski C, Stewart R, Thomson JA. Genome Biol. 2016 Aug 17;17(1):173. doi: 10.1186/s13059-016-1033-x. 10.1186/s13059-016-1033-x [pii] PubMed 27534536