Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSOD1E133K-AcGFP1
(Plasmid #83442)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 83442 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAcGFP1-N1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4700
  • Total vector size (bp) 5184
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SOD1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    720
  • Mutation
    E133K
  • Entrez Gene
    SOD1 (a.k.a. ALS, ALS1, HEL-S-44, IPOA, SOD, STAHP, hSod1, homodimer)
  • Promoter CMV
  • Tag / Fusion Protein
    • AcGFP1 (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer CMF_F
  • 3′ sequencing primer AcGFP1_R (GGCCATTCACATCGCCATTC)
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Elizabeth Fisher( pF147 pSOD1A4VAcGFP1, #26408).

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Mutation (described in http://alsod.iop.kcl.ac.uk/) was created using the method described in PMID: 17446874. Two outer and two mutation-site primers were used. The mutated PCR product and the backbone vector were digested using EcoRI and SalI, gel purified and ligated.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSOD1E133K-AcGFP1 was a gift from Mohan Babu (Addgene plasmid # 83442 ; http://n2t.net/addgene:83442 ; RRID:Addgene_83442)
  • For your References section:

    A Map of Human Mitochondrial Protein Interactions Linked to Neurodegeneration Reveals New Mechanisms of Redox Homeostasis and NF-kappaB Signaling. Malty RH, Aoki H, Kumar A, Phanse S, Amin S, Zhang Q, Minic Z, Goebels F, Musso G, Wu Z, Abou-Tok H, Meyer M, Deineko V, Kassir S, Sidhu V, Jessulat M, Scott NE, Xiong X, Vlasblom J, Prasad B, Foster LJ, Alberio T, Garavaglia B, Yu H, Bader GD, Nakamura K, Parkinson J, Babu M. Cell Syst. 2017 Nov 7. pii: S2405-4712(17)30447-7. doi: 10.1016/j.cels.2017.10.010. 10.1016/j.cels.2017.10.010 PubMed 29128334