-
PurposeLentiviral vector for mammalian expression of doxycycline-inducible Cas9 and constitutive expression of Blasticidin S deaminase -T2A -rtTA
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 83481 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCW-Cas9 (#50661)
-
Backbone manufacturerEric Lander, David Sabatini
- Backbone size w/o insert (bp) 11900
- Total vector size (bp) 11687
-
Modifications to backbonepuromycin N-acetyltransferase was replaced by blasticidin S deaminase
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsNo more than 16-hour culture.
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameSpCas9
-
MutationReplaced puromycin N-acetyltransferase on the original plasmid
- Promoter Tight Tre
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer Unknown
- 3′ sequencing primer Unknown (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameBlasticidin S deaminase -T2A - reverse tetracycline-controlled transactivator
- Promoter human phosphoglycerate kinase 1 promoter
Cloning Information for Gene/Insert 2
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer O.PGK1b_F (CACATTCTTCACGTCCGTTC)
- 3′ sequencing primer GTCGCGATGTGAGAGGAGAG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byEric Lander, David Sabatini (backbone, pCW-Cas9, #50661), Feng Zhang (insert, lentiCas9-Blast #52962).
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Blasticidin gene was amplified from lentiCas9-Blast using primers F: TCTCCCCAGCAATTCACCatggccaagcctttgtctc, R: CAAGTGAGGAGAGAACCTCTACCTTCttagccctcccacacataacc. The PCR product was gel-purified and used to perform CPEC cloning on pCW-Cas9, as described in 21293463.
Because a previous version of this plasmid contained a STOP codon between the blasticidin resistance gene and rtTA, this stop codon was subsequently removed. The following primers were used to confirm removal of the STOP codon:
Forward primer: GTGTTCCGCATTCTGCAAG
Reverse primer: ACGTGCCAGTACAGGGTAGG
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCW-Cas9-Blast was a gift from Mohan Babu (Addgene plasmid # 83481 ; http://n2t.net/addgene:83481 ; RRID:Addgene_83481)