-
PurposeLentiviral SpCas9-gRNA expression vector with DsRed-Express2-P2A-BlastR
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 83919 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneFUGW
- Total vector size (bp) 15000
-
Vector typeLentiviral, CRISPR
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameDsRed-Express2
-
Insert Size (bp)675
-
GenBank IDFJ226077.1
- Promoter hUbC
-
Tag
/ Fusion Protein
- P2A (C terminal on backbone)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer gttggcgagtgtgttttgtg (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameBsr
-
Alt nameblasticidin-S deaminase from Bacillus cereus
-
Insert Size (bp)422
-
Tag
/ Fusion Protein
- P2A (N terminal on insert)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Digest with BsmBI to remove ~1.9 kb stuffer for cloning in protospacer sequences.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV-U6-gRNA-UbC-DsRed-P2A-Bsr was a gift from Charles Gersbach (Addgene plasmid # 83919 ; http://n2t.net/addgene:83919 ; RRID:Addgene_83919) -
For your References section:
CRISPR-Cas9 epigenome editing enables high-throughput screening for functional regulatory elements in the human genome. Klann TS, Black JB, Chellappan M, Safi A, Song L, Hilton IB, Crawford GE, Reddy TE, Gersbach CA. Nat Biotechnol. 2017 Apr 3. doi: 10.1038/nbt.3853. 10.1038/nbt.3853 PubMed 28369033