pACYC-Skp-hLYZ
(Plasmid
#83924)
-
PurposeCo-expresses cytoplasmic copies of the Skp protein folding chaperone and wild type human lysozyme..
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 83924 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepACYCDuet-1
-
Backbone manufacturerEMD Millipore
- Total vector size (bp) 4708
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameSkp
-
SpeciesE. coli
- Promoter T7
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer ggatctcgacgctctccct
- 3′ sequencing primer gattatgcggccgtgtacaa (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namelysozyme
-
Alt namehuman lysozyme
-
SpeciesH. sapiens (human)
- Promoter T7
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer ttgtacacggccgcataatc
- 3′ sequencing primer gctagttattgctcagcgg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pACYC-Skp-hLYZ was a gift from Karl Griswold (Addgene plasmid # 83924 ; http://n2t.net/addgene:83924 ; RRID:Addgene_83924) -
For your References section:
Engineering Escherichia coli for soluble expression and single step purification of active human lysozyme. Lamppa JW, Tanyos SA, Griswold KE. J Biotechnol. 2013 Mar 10;164(1):1-8. doi: 10.1016/j.jbiotec.2012.11.007. Epub 2012 Dec 7. 10.1016/j.jbiotec.2012.11.007 PubMed 23220215