Skip to main content

pLenti-sgRELA
(Plasmid #83944)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 83944 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLenti-sgRNA
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRELA
  • gRNA/shRNA sequence
    GGAAGATCTCATCCCCACCG
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer CATATACGATACAAGGCTGTT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-sgRELA was a gift from David Sabatini (Addgene plasmid # 83944 ; http://n2t.net/addgene:83944 ; RRID:Addgene_83944)
  • For your References section:

    A genome-wide CRISPR screen identifies a restricted set of HIV host dependency factors. Park RJ, Wang T, Koundakjian D, Hultquist JF, Lamothe-Molina P, Monel B, Schumann K, Yu H, Krupzcak KM, Garcia-Beltran W, Piechocka-Trocha A, Krogan NJ, Marson A, Sabatini DM, Lander ES, Hacohen N, Walker BD. Nat Genet. 2016 Dec 19. doi: 10.1038/ng.3741. 10.1038/ng.3741 PubMed 27992415