pCFD4d
(Plasmid
#83954)
-
Purpose(Empty Backbone) Modified from pCFD4, with the vermillion marker and the attB site removed
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 83954 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCFD4-U6:1_U6:3tandemgRNAs
-
Backbone manufacturerSimon Bullock
- Backbone size (bp) 4575
-
Modifications to backboneremoved the vermillion marker and the attB site
-
Vector typeCRISPR
- Promoter dU6-1; dU6-3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer ATTCCTATCCGGCGGTAGTC
- 3′ sequencing primer TGTACGTCAACGGAAAACCA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCFD4d was a gift from Phillip Zamore (Addgene plasmid # 83954 ; http://n2t.net/addgene:83954 ; RRID:Addgene_83954) -
For your References section:
Rapid Screening for CRISPR-Directed Editing of the Drosophila Genome Using white Co-conversion. Ge DT, Tipping C, Brodsky MH, Zamore PD. G3 (Bethesda). 2016 Aug 26. pii: g3.116.032557. doi: 10.1534/g3.116.032557. 10.1534/g3.116.032557 PubMed 27543296