Skip to main content

pRRL_SRSF2_WT_mCherry
(Plasmid #84020)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 84020 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pRRLSIN.cPPT.PGK-GFP.WPRE
  • Backbone manufacturer
    Didier Trono (Addgene plasmid # 12252)
  • Backbone size w/o insert (bp) 6651
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SRSF2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1458
  • Entrez Gene
    SRSF2 (a.k.a. PR264, SC-35, SC35, SFRS2, SFRS2A, SRp30b)
  • Promoter PGK
  • Tags / Fusion Proteins
    • Flag (C terminal on insert)
    • 2TA-mCherry (C terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer ggggttggggttgcgccttt (hPGK)
  • 3′ sequencing primer TTACTTGTACAGCTCGTCCA
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Aravind Ramakrishnan, FHCRC clinical research division
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRRL_SRSF2_WT_mCherry was a gift from Robert Bradley (Addgene plasmid # 84020 ; http://n2t.net/addgene:84020 ; RRID:Addgene_84020)
  • For your References section:

    SRSF2 Mutations Contribute to Myelodysplasia by Mutant-Specific Effects on Exon Recognition. Kim E, Ilagan JO, Liang Y, Daubner GM, Lee SC, Ramakrishnan A, Li Y, Chung YR, Micol JB, Murphy ME, Cho H, Kim MK, Zebari AS, Aumann S, Park CY, Buonamici S, Smith PG, Deeg HJ, Lobry C, Aifantis I, Modis Y, Allain FH, Halene S, Bradley RK, Abdel-Wahab O. Cancer Cell. 2015 May 11;27(5):617-30. doi: 10.1016/j.ccell.2015.04.006. 10.1016/j.ccell.2015.04.006 PubMed 25965569