Skip to main content
Addgene

pX601-mCherry
(Plasmid #84039)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 84039 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pX601
  • Backbone manufacturer
    Feng Zhang's laboratory
  • Backbone size w/o insert (bp) 7447
  • Total vector size (bp) 8122
  • Modifications to backbone
    inserted mcherry downstream of SaCas9
  • Vector type
    Mammalian Expression, AAV, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    SaCas9
  • Alt name
    SauCas9
  • gRNA/shRNA sequence
    empty vector
  • Species
    Staphylococcus aureus
  • Promoter CMV
  • Tags / Fusion Proteins
    • NLS (N terminal on insert)
    • NLS (C terminal on insert)
    • T2A-mCherry (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site EcoR I (not destroyed)
  • 5′ sequencing primer Cas9-HidIII-S: gccccgtcgtgaagagaagcttcatcc
  • 3′ sequencing primer mCherry –EcoR1-AS:cgtagaattcttacttgtacagctcgtccatgccgccggt
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX601-mCherry was a gift from Yuet Wai Kan (Addgene plasmid # 84039 ; http://n2t.net/addgene:84039 ; RRID:Addgene_84039)
  • For your References section:

    Genome editing using CRISPR-Cas9 to create the HPFH genotype in HSPCs: An approach for treating sickle cell disease and beta-thalassemia. Ye L, Wang J, Tan Y, Beyer AI, Xie F, Muench MO, Kan YW. Proc Natl Acad Sci U S A. 2016 Sep 20;113(38):10661-5. doi: 10.1073/pnas.1612075113. Epub 2016 Sep 6. 10.1073/pnas.1612075113 PubMed 27601644