-
PurposeExpresses GA-inducible KRAB-Sp dCas9
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 84242 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonePB
-
Backbone manufacturerSystem Biosciences
- Total vector size (bp) 13807
-
Vector typeMammalian Expression, CRISPR, Synthetic Biology ; PiggyBac
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameGAI-tagBFP-Sp dCas9
-
SpeciesA. thaliana (mustard weed), Synthetic; S. pyogenes
-
Insert Size (bp)5253
- Promoter PGK
-
Tags
/ Fusion Proteins
- GAI (N terminal on insert)
- tagBFP (N terminal on insert)
- HA tag (C terminal on insert)
- 2xNLS (SV40) (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer gaaggtcctccggaggcc
- 3′ sequencing primer CGGTCTGTATATCGAGGTTTATTTATTAATTTG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameGID1-KRAB
-
SpeciesA. thaliana (mustard weed), Synthetic
-
Insert Size (bp)1296
- Promoter CAG
-
Tags
/ Fusion Proteins
- GID1 (N terminal on insert)
- IRES-Puro (C terminal on backbone)
Cloning Information for Gene/Insert 2
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer tcggcttctggcgtgtga
- 3′ sequencing primer gacggcaatatggtggaaaataac (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe dCas9 gene was a gift from Martin Jinek and Jennifer Doudna (UC Berkeley). The GAI and GID1 domains were gifts from Takanari Inoue (Johns Hopkins)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSLQ2813 pPB: CAG-GID1-KRAB-IRES-Puro-WPRE PGK-ABI-tagBFP-SpdCas9 was a gift from Stanley Qi (Addgene plasmid # 84242 ; http://n2t.net/addgene:84242 ; RRID:Addgene_84242) -
For your References section:
Complex transcriptional modulation with orthogonal and inducible dCas9 regulators. Gao Y, Xiong X, Wong S, Charles EJ, Lim WA, Qi LS. Nat Methods. 2016 Oct 24. doi: 10.1038/nmeth.4042. 10.1038/nmeth.4042 PubMed 27776111