pSLQ1852-2 pHR: U6-SpsgCD95-1 CMV-EGFP
(Plasmid
#84251)
-
PurposeExpresses Sp sgCD95-1 gRNA with an EGFP fluorescent marker
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 84251 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepHR
- Total vector size (bp) 7656
-
Vector typeMammalian Expression, Lentiviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSp sgCD95-1
-
gRNA/shRNA sequenceGTACAGCAGAAGCCTTTAGAA
-
SpeciesH. sapiens (human), Synthetic; S. pyogenes
- Promoter mouse U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BstXI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer GAGATCCAGTTTGGTTAGTACCGGG
- 3′ sequencing primer ATGCATGGCGGTAATACGGTTAT
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Contains a CMV-EGFP fluorescent marker 3' of the sgRNA.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSLQ1852-2 pHR: U6-SpsgCD95-1 CMV-EGFP was a gift from Stanley Qi (Addgene plasmid # 84251 ; http://n2t.net/addgene:84251 ; RRID:Addgene_84251) -
For your References section:
Complex transcriptional modulation with orthogonal and inducible dCas9 regulators. Gao Y, Xiong X, Wong S, Charles EJ, Lim WA, Qi LS. Nat Methods. 2016 Oct 24. doi: 10.1038/nmeth.4042. 10.1038/nmeth.4042 PubMed 27776111