pEpic
(Plasmid
#84372)
-
Purpose(Empty Backbone) 3rd-generation lentiviral destination vector for gateway cloning with puromycin resistance.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 84372 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepLenti PGK PURO DEST (Addgene 19068)
- Backbone size (bp) 9093
-
Modifications to backbonepEpic was made by blunt-end cloning the XhoI/ClaI-defined attR4-attR3 cassette from pDestTol2pA2 into the 7.3kb EcoRV fragment of pLenti PGK PURO DEST, effectively replacing its attR1-attR2 cassette.
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Growth instructionsMay take up to 48 hr for single colonies to form on plates.
-
Copy numberUnknown
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer pTYF-5 (GTAGACATAATAGCAACAGAC)
- 3′ sequencing primer WPRE-R (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEpic was a gift from Kryn Stankunas (Addgene plasmid # 84372 ; http://n2t.net/addgene:84372 ; RRID:Addgene_84372) -
For your References section:
A MultiSite Gateway Toolkit for Rapid Cloning of Vertebrate Expression Constructs with Diverse Research Applications. Fowler DK, Stewart S, Seredick S, Eisen JS, Stankunas K, Washbourne P. PLoS One. 2016 Aug 8;11(8):e0159277. doi: 10.1371/journal.pone.0159277. eCollection 2016. PONE-D-16-19476 [pii] PubMed 27500400