Skip to main content
Holiday Schedule: Addgene will be closed December 24 - December 31. Order processing and shipping will resume on January 3, 2022. For questions about estimated ship dates, please feel free to track your order status or contact [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #84373)


Item Catalog # Description Quantity Price (USD)
Plasmid 84373 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size (bp) 7992
  • Modifications to backbone
    pEpic_Lite was created by removing the PuroR cassette by AgeI/ApaI restriction enzyme digestion, filling in 5’ overhangs with DNA polymerase I Klenow fragment, and blunt-end ligation with T4 DNA ligase.
  • Vector type

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin
  • Growth Temperature
  • Growth Strain(s)
    ccdB Survival
  • Copy number

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer pTYF-5 (GTAGACATAATAGCAACAGAC)
  • 3′ sequencing primer WPRE-R
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEpic_Lite was a gift from Philip Washbourne (Addgene plasmid # 84373 ; ; RRID:Addgene_84373)
  • For your References section:

    A MultiSite Gateway Toolkit for Rapid Cloning of Vertebrate Expression Constructs with Diverse Research Applications. Fowler DK, Stewart S, Seredick S, Eisen JS, Stankunas K, Washbourne P. PLoS One. 2016 Aug 8;11(8):e0159277. doi: 10.1371/journal.pone.0159277. eCollection 2016. PONE-D-16-19476 [pii] PubMed 27500400