pEpic_Lite
(Plasmid
#84373)
-
Purpose(Empty Backbone) 3rd-generation lentiviral destination vector for gateway cloning
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 84373 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEpic
- Backbone size (bp) 7992
-
Modifications to backbonepEpic_Lite was created by removing the PuroR cassette by AgeI/ApaI restriction enzyme digestion, filling in 5’ overhangs with DNA polymerase I Klenow fragment, and blunt-end ligation with T4 DNA ligase.
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberUnknown
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer pTYF-5 (GTAGACATAATAGCAACAGAC)
- 3′ sequencing primer WPRE-R
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEpic_Lite was a gift from Philip Washbourne (Addgene plasmid # 84373 ; http://n2t.net/addgene:84373 ; RRID:Addgene_84373) -
For your References section:
A MultiSite Gateway Toolkit for Rapid Cloning of Vertebrate Expression Constructs with Diverse Research Applications. Fowler DK, Stewart S, Seredick S, Eisen JS, Stankunas K, Washbourne P. PLoS One. 2016 Aug 8;11(8):e0159277. doi: 10.1371/journal.pone.0159277. eCollection 2016. PONE-D-16-19476 [pii] PubMed 27500400