Skip to main content

V1-MESA-45F-Tev-MS2-p65-HSF1
(Plasmid #84505)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 84505 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGIPZ
  • Backbone manufacturer
    Open Biosystems
  • Backbone size w/o insert (bp) 9213
  • Total vector size (bp) 14162
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    V1-MESA-45F-Tev
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    1587
  • Promoter CMV
  • Tag / Fusion Protein
    • Flag (N terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site AscI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CAAAAGACGGCAATATGGTGG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    MS2-P65-HSF1
  • Species
    Synthetic
  • Insert Size (bp)
    1419
  • Promoter CMV

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsiWI (not destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer GGACGTGGTTTTCCTTTG
  • 3′ sequencing primer CATGTTAGCAGACTTCCTC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    MS2-P65-HSF1 obtained from Feng Zhang lab at MIT (plasmid lenti MS2-P65-HSF1_Hygro - Addgene# 61426)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    V1-MESA-45F-Tev-MS2-p65-HSF1 was a gift from Joshua Leonard (Addgene plasmid # 84505 ; http://n2t.net/addgene:84505 ; RRID:Addgene_84505)
  • For your References section:

    Rewiring human cellular input-output using modular extracellular sensors. Schwarz KA, Daringer NM, Dolberg TB, Leonard JN. Nat Chem Biol. 2016 Dec 12. doi: 10.1038/nchembio.2253. 10.1038/nchembio.2253 PubMed 27941759