V1-MESA-45F-Tev-MS2-p65-HSF1
(Plasmid
#84505)
-
PurposeMESA protease chain with V1-MESA ectodomain, 45 extracellular linkers, a flag tag, and Tev protease, MS2-P65-HSF1
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 84505 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGIPZ
-
Backbone manufacturerOpen Biosystems
- Backbone size w/o insert (bp) 9213
- Total vector size (bp) 14162
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameV1-MESA-45F-Tev
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)1587
- Promoter CMV
-
Tag
/ Fusion Protein
- Flag (N terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site AscI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer CAAAAGACGGCAATATGGTGG
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameMS2-P65-HSF1
-
SpeciesSynthetic
-
Insert Size (bp)1419
- Promoter CMV
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site BsiWI (not destroyed)
- 3′ cloning site BsrGI (unknown if destroyed)
- 5′ sequencing primer GGACGTGGTTTTCCTTTG
- 3′ sequencing primer CATGTTAGCAGACTTCCTC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byMS2-P65-HSF1 obtained from Feng Zhang lab at MIT (plasmid lenti MS2-P65-HSF1_Hygro - Addgene# 61426)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
V1-MESA-45F-Tev-MS2-p65-HSF1 was a gift from Joshua Leonard (Addgene plasmid # 84505 ; http://n2t.net/addgene:84505 ; RRID:Addgene_84505) -
For your References section:
Rewiring human cellular input-output using modular extracellular sensors. Schwarz KA, Daringer NM, Dolberg TB, Leonard JN. Nat Chem Biol. 2016 Dec 12. doi: 10.1038/nchembio.2253. 10.1038/nchembio.2253 PubMed 27941759