pMyBADC
(Plasmid
#84688)
-
Purpose(Empty Backbone) Protein expression in mycobacteria
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 84688 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepMyC
-
Backbone manufacturerWilmanns lab
- Backbone size (bp) 6876
-
Modifications to backboneThe acetamidase-inducible promoter of pMyC was replaced by the E. coli arabinose-inducible promoter from pBADM11 vector using Gibson cloning. The pMyC backbone was amplified using the primers: 5’-ccatgggctcggccg and 5’-gaccgcgtcacttctttatctagatttaaagatc. The arabinose-inducible promoter from the pBAD vector was amplified using the primers: 5’-agaagtgacgcggtcctagattatgacaacttgacggctacatcattcactttttct and 5’-cggccgagcccatggggttaattcctcctgttagcccaaaaaacggg.
-
Vector typeBacterial Expression ; Bacterial expression vector
- Promoter Arabinose
-
Tag
/ Fusion Protein
- His6 (C terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Hygromycin, 200 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Cloning Information
- Cloning method Gibson Cloning
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMyBADC was a gift from Matthias Wilmanns (Addgene plasmid # 84688 ; http://n2t.net/addgene:84688 ; RRID:Addgene_84688) -
For your References section:
The pMy vector series: A versatile cloning platform for the recombinant production of mycobacterial proteins in Mycobacterium smegmatis. Beckham KSH, Staack S, Wilmanns M, Parret AHA. Protein Sci. 2020 Oct 2. doi: 10.1002/pro.3962. 10.1002/pro.3962 PubMed 33006405