Skip to main content

pMyBADC
(Plasmid #84688)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 84688 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMyC
  • Backbone manufacturer
    Wilmanns lab
  • Backbone size (bp) 6876
  • Modifications to backbone
    The acetamidase-inducible promoter of pMyC was replaced by the E. coli arabinose-inducible promoter from pBADM11 vector using Gibson cloning. The pMyC backbone was amplified using the primers: 5’-ccatgggctcggccg and 5’-gaccgcgtcacttctttatctagatttaaagatc. The arabinose-inducible promoter from the pBAD vector was amplified using the primers: 5’-agaagtgacgcggtcctagattatgacaacttgacggctacatcattcactttttct and 5’-cggccgagcccatggggttaattcctcctgttagcccaaaaaacggg.
  • Vector type
    Bacterial Expression ; Bacterial expression vector
  • Promoter Arabinose
  • Tag / Fusion Protein
    • His6 (C terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
    Hygromycin, 200 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Cloning Information

  • Cloning method Gibson Cloning

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMyBADC was a gift from Matthias Wilmanns (Addgene plasmid # 84688 ; http://n2t.net/addgene:84688 ; RRID:Addgene_84688)
  • For your References section:

    The pMy vector series: A versatile cloning platform for the recombinant production of mycobacterial proteins in Mycobacterium smegmatis. Beckham KSH, Staack S, Wilmanns M, Parret AHA. Protein Sci. 2020 Oct 2. doi: 10.1002/pro.3962. 10.1002/pro.3962 PubMed 33006405