-
Purpose(Empty Backbone) Protein expression in mycobacteria
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 84693 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepMyNT
-
Backbone manufacturerWilmanns lab
- Backbone size (bp) 6902
-
Modifications to backboneThe hygromycin resistance cassette in pMyNT was replaced by a kanamycin resistance cassette using Gibson cloning. The pMyNT backbone was amplified using the primers : 5’-gtacgctagttaactacgtcg and 5’-cgccccctctagctgatcac and the kanamycin resistance cassette from pMV306 was amplified using the primers 5’-gtgaatagaggtccgctaacaaagcgacgttgtgtctc and 5’-cagctagagggggcgctgattagaaaaactcatcgagcatcaaatg.
-
Vector typeBacterial Expression
- Promoter Acetamidase
-
Tag
/ Fusion Protein
- His6 (N terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGAGTCCACCATGAAGCACC
- 3′ sequencing primer TTGATGACGAGCGTAATGGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMyNT-kan was a gift from Matthias Wilmanns (Addgene plasmid # 84693 ; http://n2t.net/addgene:84693 ; RRID:Addgene_84693) -
For your References section:
The pMy vector series: A versatile cloning platform for the recombinant production of mycobacterial proteins in Mycobacterium smegmatis. Beckham KSH, Staack S, Wilmanns M, Parret AHA. Protein Sci. 2020 Oct 2. doi: 10.1002/pro.3962. 10.1002/pro.3962 PubMed 33006405