Skip to main content

pUB-nHyPer2 (NLS:HyPer2:NLS)
(Plasmid #84730)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 84730 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUB-DEST
  • Backbone manufacturer
    Grefen et al. The Plant Journal (2010) 64, 355–365
  • Backbone size w/o insert (bp) 9210
  • Total vector size (bp) 10647
  • Vector type
    Plant Expression
  • Selectable markers
    Basta

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    HyPer2 targeted to nucleus
  • Insert Size (bp)
    1476
  • Promoter ubiqutin- 10 gene promoter (pUBQ10) of Arabidopsis
  • Tags / Fusion Proteins
    • NLS (nuclear localisation signal) (N terminal on insert)
    • NLS (nuclear localisation signal (C terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer CGATTTTCTGGGTTTGATCGTT
  • 3′ sequencing primer AGGTCACTGGATTTTGGTTTTAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUB-nHyPer2 (NLS:HyPer2:NLS) was a gift from Philip Mullineaux (Addgene plasmid # 84730 ; http://n2t.net/addgene:84730 ; RRID:Addgene_84730)
  • For your References section:

    Photosynthesis-dependent H2O2 transfer from chloroplasts to nuclei provides a high-light signalling mechanism. Exposito-Rodriguez M, Laissue PP, Yvon-Durocher G, Smirnoff N, Mullineaux PM. Nat Commun. 2017 Jun 29;8(1):49. doi: 10.1038/s41467-017-00074-w. 10.1038/s41467-017-00074-w [pii] PubMed 28663550