Skip to main content
Addgene

pGem-nHyPer2:sHyper2
(Plasmid #84737)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 84737 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGemini (Dr. Andrew Simkin)
  • Backbone manufacturer
    pGWB2
  • Backbone size w/o insert (bp) 16636
  • Total vector size (bp) 19435
  • Modifications to backbone
    bi-directional vector built in house where the expression of two transgenes is driven by back-to-back CaMV35s and Figwort Mosaic Virus (FMV) constitutive promoters.
  • Vector type
    Plant Expression
  • Selectable markers
    Hygromycin ; Kanamycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    HyPer2 targeted to nucleus
  • Insert Size (bp)
    1479
  • Promoter pFMV/p35S
  • Tags / Fusion Proteins
    • NLS-SV40 (N terminal on insert)
    • NLS-SV40 (C terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer pFMV34S atcgagcagcagctggcttgtgg/pCaM35S catcgttgaagatgcctctgc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGem-nHyPer2:sHyper2 was a gift from Philip Mullineaux (Addgene plasmid # 84737 ; http://n2t.net/addgene:84737 ; RRID:Addgene_84737)
  • For your References section:

    Photosynthesis-dependent H2O2 transfer from chloroplasts to nuclei provides a high-light signalling mechanism. Exposito-Rodriguez M, Laissue PP, Yvon-Durocher G, Smirnoff N, Mullineaux PM. Nat Commun. 2017 Jun 29;8(1):49. doi: 10.1038/s41467-017-00074-w. 10.1038/s41467-017-00074-w [pii] PubMed 28663550