-
PurposeMinimos transposon with Peft-3:GFP:tbb-2 3'UTR and cbr-unc-119 selection. GFP was optimized for C. elegans, contains 2x NLS (SV40/egl-13), and smu-1 introns
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 84828 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepDESTR4-R3
-
Backbone manufacturerInvitrogen
-
Vector typeBacterial Expression, Worm Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameC. elegans codon optimized GFP
-
SpeciesC. elegans (nematode)
- Promoter Peft-3
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer gaacagctatgaccatgattacg
- 3′ sequencing primer M13F (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Expression vector with C. elegans codon-optimized GFP under the eft-3 promoter and with the tbb-2 3'UTR.
Cloned into pCFJ150 for compatibility with mosSCI.
Contains cbr-unc-119 rescue fragment.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCFJ1415 was a gift from Andrew Fire (Addgene plasmid # 84828 ; http://n2t.net/addgene:84828 ; RRID:Addgene_84828) -
For your References section:
An Abundant Class of Non-coding DNA Can Prevent Stochastic Gene Silencing in the C. elegans Germline. Frokjaer-Jensen C, Jain N, Hansen L, Davis MW, Li Y, Zhao D, Rebora K, Millet JR, Liu X, Kim SK, Dupuy D, Jorgensen EM, Fire AZ. Cell. 2016 Jul 14;166(2):343-57. doi: 10.1016/j.cell.2016.05.072. Epub 2016 Jun 30. 10.1016/j.cell.2016.05.072 PubMed 27374334