Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pPTK006-3a-αMF no EAEA
(Plasmid #84965)


Item Catalog # Description Quantity Price (USD)
Plasmid 84965 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Lee et al. (2015), ACS Synth. Biol. 4, 975–986.
  • Backbone size w/o insert (bp) 1662
  • Total vector size (bp) 1920
  • Vector type
    Yeast Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    α-mating factor no EAEA secretion tag
  • Alt name
    αMF no EAEA
  • Species
  • Insert Size (bp)
  • Promoter Non

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer ccttttgctggccttttgctc
  • 3′ sequencing primer ccagtaatgacctcagaactcc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Depositor Comments

Design of this plasmid was performed according to the described Methods in Lee et al. 2015 (A Highly Characterized Yeast Toolkit for Modular, Multipart Assembly) and this plasmid is compatible with the existing toolkit (MoClo-YTK, Kit number 1000000061)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPTK006-3a-αMF no EAEA was a gift from Volker Sieber (Addgene plasmid # 84965 ; ; RRID:Addgene_84965)
  • For your References section:

    A Modular Toolkit for Generating Pichia pastoris Secretion Libraries. Obst U, Lu TK, Sieber V. ACS Synth Biol. 2017 Mar 15. doi: 10.1021/acssynbio.6b00337. 10.1021/acssynbio.6b00337 PubMed 28252957