pPTK021-7-PARS
(Plasmid
#84990)
-
PurposeType 7, Pichia autonomously replicating sequence
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 84990 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepYTK001-EntryVector
-
Backbone manufacturerLee et al. (2015), ACS Synth. Biol. 4, 975–986.
- Backbone size w/o insert (bp) 1662
- Total vector size (bp) 1841
-
Vector typeYeast Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePichia autonomously replicating sequence
-
Alt namePARS
-
SpeciesSynthetic
-
Insert Size (bp)175
- Promoter Non
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer ccttttgctggccttttgctc
- 3′ sequencing primer ccagtaatgacctcagaactcc
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Design of this plasmid was performed according to the described Methods in Lee et al. 2015 (A Highly Characterized Yeast Toolkit for Modular, Multipart Assembly) and this plasmid is compatible with the existing toolkit (MoClo-YTK, Kit number 1000000061)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPTK021-7-PARS was a gift from Volker Sieber (Addgene plasmid # 84990 ; http://n2t.net/addgene:84990 ; RRID:Addgene_84990) -
For your References section:
A Modular Toolkit for Generating Pichia pastoris Secretion Libraries. Obst U, Lu TK, Sieber V. ACS Synth Biol. 2017 Mar 15. doi: 10.1021/acssynbio.6b00337. 10.1021/acssynbio.6b00337 PubMed 28252957