-
PurposeFor AAV-TRE-Cre based Supernova, pK170 should be used with pK168 etc.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 85040 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV-TRE-MCS-WPRE
- Backbone size w/o insert (bp) 3776
- Total vector size (bp) 5510
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namenlsCre-WPRE
-
SpeciesSV40, P1 phage,Woodchuck hepatitis virus
-
Insert Size (bp)1734
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site BglII (not destroyed)
- 5′ sequencing primer GAGAACGTATGTCGAGGTAGGCGTGTAC
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For the details of pAAV-TRE-MCS-WPRE, see Hayashi, Y. et al., Science 350, 957-961 (2016).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pK170.AAV-TRE-Cre-WPRE (Supernova) was a gift from Takuji Iwasato (Addgene plasmid # 85040 ; http://n2t.net/addgene:85040 ; RRID:Addgene_85040) -
For your References section:
Supernova: A Versatile Vector System for Single-Cell Labeling and Gene Function Studies in vivo. Luo W, Mizuno H, Iwata R, Nakazawa S, Yasuda K, Itohara S, Iwasato T. Sci Rep. 2016 Oct 24;6:35747. doi: 10.1038/srep35747. 10.1038/srep35747 PubMed 27775045