pF709-pET28a-Hs-FL-ETFbeta-NHis wt
(Plasmid
#85110)
-
Purposeexpression of recombinant human full-length ETFbeta wt with N-terminal 6xHis-tag
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 85110 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET28a
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namehuman full-length ETFbeta
-
SpeciesH. sapiens (human)
-
Insert Size (bp)768
-
Entrez GeneETFB (a.k.a. FP585, MADD)
- Promoter T7
-
Tag
/ Fusion Protein
- 6xHis (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer ATGCGTCCGGCGTAGAGG
- 3′ sequencing primer TAGAGGCCCCAAGGGGTTATGCTAG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Homo sapiens wt ETF beta, full-length, cloned into NdeI-HindIII sites of pET28a, contains a N-terminal His-tag
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pF709-pET28a-Hs-FL-ETFbeta-NHis wt was a gift from Pal Falnes (Addgene plasmid # 85110 ; http://n2t.net/addgene:85110 ; RRID:Addgene_85110) -
For your References section:
Human METTL20 is a mitochondrial lysine methyltransferase that targets the beta subunit of electron transfer flavoprotein (ETFbeta) and modulates its activity. Malecki J, Ho AY, Moen A, Dahl HA, Falnes PO. J Biol Chem. 2015 Jan 2;290(1):423-34. doi: 10.1074/jbc.M114.614115. Epub 2014 Nov 21. 10.1074/jbc.M114.614115 PubMed 25416781