Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pF711-pET28a-Hs-delta25-MCAD-NHis wt
(Plasmid #85112)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 85112 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    human mature (delta25) MCAD
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1191
  • Entrez Gene
    ACADM (a.k.a. ACAD1, MCAD, MCADH)
  • Promoter T7
  • Tag / Fusion Protein
    • 6xHis (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer ATGCGTCCGGCGTAGAGG
  • 3′ sequencing primer TAGAGGCCCCAAGGGGTTATGCTAG
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry

Depositor Comments

Homo sapiens wt MCAD, delta 25, cloned into NdeI-NotI sites of pET28a, contains a N-terminal His-tag

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pF711-pET28a-Hs-delta25-MCAD-NHis wt was a gift from Pal Falnes (Addgene plasmid # 85112 ; http://n2t.net/addgene:85112 ; RRID:Addgene_85112)
  • For your References section:

    Human METTL20 is a mitochondrial lysine methyltransferase that targets the beta subunit of electron transfer flavoprotein (ETFbeta) and modulates its activity. Malecki J, Ho AY, Moen A, Dahl HA, Falnes PO. J Biol Chem. 2015 Jan 2;290(1):423-34. doi: 10.1074/jbc.M114.614115. Epub 2014 Nov 21. 10.1074/jbc.M114.614115 PubMed 25416781