pSB1A3 EcoRI Methylase-AmilCP
(Plasmid
#85166)
-
PurposeFor methylating EcoRI recognition sites in order to prevent cleavage by the EcoRI restriction enzyme. AmilCP is a blue reporter for Methylase expression.
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 85166 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepSB1A3
-
Backbone manufactureriGEM
- Backbone size w/o insert (bp) 2155
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEcoRI Methylase-AmilCP
-
Alt nameAmilCP tagged Methylase
-
SpeciesE. coli strain RY13
-
Insert Size (bp)1721
- Promoter J23100 promoter
-
Tag
/ Fusion Protein
- AmilCP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI, XbaI (not destroyed)
- 3′ cloning site SpeI, PstI (not destroyed)
- 5′ sequencing primer VF2 (5' tgccacctgacgtctaagaa 3')
- 3′ sequencing primer VR (5' attaccgcctttgagtgagc 3') (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byPromoter and AmilCP were acquired from iGEM repository.
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The methylase will methylate the EcoRI cloning site, rendering the site nonfunctional.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSB1A3 EcoRI Methylase-AmilCP was a gift from Robin Dowell (Addgene plasmid # 85166 ; http://n2t.net/addgene:85166 ; RRID:Addgene_85166) -
For your References section:
Engineered calcium-precipitable restriction enzyme. Hendrix J, Read T, Lalonde JF, Jensen PK, Heymann W, Lovelace E, Zimmermann SA, Brasino M, Rokicki J, Dowell RD. ACS Synth Biol. 2014 Dec 19;3(12):969-71. doi: 10.1021/sb500042m. 10.1021/sb500042m PubMed 25524101