Skip to main content
Addgene

pSB1A3 EcoRI Methylase-AmilCP
(Plasmid #85166)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 85166 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSB1A3
  • Backbone manufacturer
    iGEM
  • Backbone size w/o insert (bp) 2155
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    EcoRI Methylase-AmilCP
  • Alt name
    AmilCP tagged Methylase
  • Species
    E. coli strain RY13
  • Insert Size (bp)
    1721
  • Promoter J23100 promoter
  • Tag / Fusion Protein
    • AmilCP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI, XbaI (not destroyed)
  • 3′ cloning site SpeI, PstI (not destroyed)
  • 5′ sequencing primer VF2 (5' tgccacctgacgtctaagaa 3')
  • 3′ sequencing primer VR (5' attaccgcctttgagtgagc 3')
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Promoter and AmilCP were acquired from iGEM repository.
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The methylase will methylate the EcoRI cloning site, rendering the site nonfunctional.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSB1A3 EcoRI Methylase-AmilCP was a gift from Robin Dowell (Addgene plasmid # 85166 ; http://n2t.net/addgene:85166 ; RRID:Addgene_85166)
  • For your References section:

    Engineered calcium-precipitable restriction enzyme. Hendrix J, Read T, Lalonde JF, Jensen PK, Heymann W, Lovelace E, Zimmermann SA, Brasino M, Rokicki J, Dowell RD. ACS Synth Biol. 2014 Dec 19;3(12):969-71. doi: 10.1021/sb500042m. 10.1021/sb500042m PubMed 25524101