-
Purpose(Empty Backbone) Backbone for lentiviral gene silencing with monomeric Kusabira-Orange2 expression
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 85208 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLKO.1 - TRC cloning vector
-
Backbone manufacturerDavid Root (Addgene #10878)
- Backbone size (bp) 7032
-
Modifications to backbonePuromycin N-acetyltransferase resistance was removed with BamHI and KpnI and inserted monomeric Kusabira-Orange2 for fluorescence expression.
-
Vector typeMammalian Expression, Lentiviral, RNAi
- Promoter RNA polymerase III promoter for human U6 snRNA for shRNA and hPGK promoter for mKO2
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer GACTATCATATGCTTACCGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The 1.9kb stuffer can be released with AgeI and EcoRI and replaced with your shRNA sequence of choice.
Also, see Addgene's pLKO.1 protocol http://www.addgene.org/plko on how to use the pLKO.1 vector.
Plasmid grows more slowly than standard plasmids.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO.1-TRC.mKO2 was a gift from Sandra Martha Gomes Dias (Addgene plasmid # 85208 ; http://n2t.net/addgene:85208 ; RRID:Addgene_85208) -
For your References section:
Guanylate-binding protein-1 is a potential new therapeutic target for triple-negative breast cancer. Quintero M, Adamoski D, Reis LMD, Ascencao CFR, Oliveira KRS, Goncalves KA, Dias MM, Carazzolle MF, Dias SMG. BMC Cancer. 2017 Nov 7;17(1):727. doi: 10.1186/s12885-017-3726-2. 10.1186/s12885-017-3726-2 [pii] PubMed 29115931