mTiam1-mcherry-sspB in pcDNA3.1
(Plasmid
#85221)
-
PurposeRole of Rac selective GEF domain from Tiam1 in immune cell migration
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 85221 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepcDNA3.1
-
Backbone manufacturerinvitrogen
- Backbone size w/o insert (bp) 5428
- Total vector size (bp) 8295
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namemTiam1 (1030-1406)
-
Alt nameTiam1
-
SpeciesM. musculus (mouse)
-
GenBank IDNP_033410
-
Entrez GeneTiam1 (a.k.a. D16Ium10, D16Ium10e)
- Promoter CMV
-
Tag
/ Fusion Protein
- none
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site EcoR1 (not destroyed)
- 5′ sequencing primer T7 primer
- 3′ sequencing primer BGH reverse primer (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namemcherry
-
SpeciesSynthetic
-
Insert Size (bp)710
- Promoter CMV
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site EcoR1 (destroyed during cloning)
- 3′ cloning site BspE1 (not destroyed)
- 5′ sequencing primer cgggttttccacctctgctgc (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert namesspB
-
Speciesbacterial
- Promoter CMV
Cloning Information for Gene/Insert 3
- Cloning method Restriction Enzyme
- 5′ cloning site BspE1 (destroyed during cloning)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer ggactacaccatcgtggaacagtacgaacg (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mTiam1-mcherry-sspB in pcDNA3.1 was a gift from Narasimhan Gautam (Addgene plasmid # 85221 ; http://n2t.net/addgene:85221 ; RRID:Addgene_85221) -
For your References section:
Subcellular optogenetic activation of Cdc42 controls local and distal signaling to drive immune cell migration. O'Neill PR, Kalyanaraman V, Gautam N. Mol Biol Cell. 2016 May 1;27(9):1442-50. doi: 10.1091/mbc.E15-12-0832. Epub 2016 Mar 3. 10.1091/mbc.E15-12-0832 PubMed 26941336