PR_GEF (2XPDZ-mCherry-Larg (DH)
(Plasmid #80407)

• Purpose: Recruitable mCherry tagged RhoA GEF LARG (DH domain). Expresses in mammalian cells
• Depositing Lab: Michael Glotzer
• Publication: Wagner et al J Cell Biol. 2016 Jun 20;213(6):641-9. doi: 10.1083/jcb.201603025. Epub 2016 Jun 13.

Backbone

• Vector backbone: pEGFP-N1
• Backbone size w/o insert (bp): 3976
• Total vector size (bp): 6106
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: 2XPDZ_mCherry_LARG DH (aa 766-997)
• Species: H. sapiens (human)
• Insert Size (bp): 2130
• Mutation: DH domain only (aa 766-997)
• GenBank ID: NM_015313.2
• Entrez Gene: ARHGEF12 (a.k.a. LARG, PRO2792)
• Promoter: CMV
• Tag / Fusion Protein:
  • mCherry

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: Not1 (not destroyed)
• 5′ sequencing primer: GGTTTAGTGAACCGTCAGATCCGCTAGCGC
• 3′ sequencing primer: CCTCTACAAATGTGGTATGGCTG

Resource Information

• Articles Citing this Plasmid:
  • 5 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry