-
PurposeLentiviral FRT-flanked EF1alfa-GFP PGK-PuromycinR cassette
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 85442 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTYF
- Backbone size w/o insert (bp) 6458
- Total vector size (bp) 10503
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameFRT-flanked EF1alfa-GFP PGK-Puromycin cassette
-
SpeciesEGFP: Aequorea victoria
-
Insert Size (bp)4045
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site BamHI (destroyed during cloning)
- 5′ sequencing primer 5'- gtagacataatagcaacagac -3'
- 3′ sequencing primer 5'- GAA AGG ACA GTG GGA GTG GCA C -3' (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Launchpad (AVA2590) was a gift from Joan Steitz (Addgene plasmid # 85442 ; http://n2t.net/addgene:85442 ; RRID:Addgene_85442) -
For your References section:
Fluorescence Amplification Method for Forward Genetic Discovery of Factors in Human mRNA Degradation. Alexandrov A, Shu MD, Steitz JA. Mol Cell. 2017 Jan 5;65(1):191-201. doi: 10.1016/j.molcel.2016.11.032. Epub 2016 Dec 22. 10.1016/j.molcel.2016.11.032 PubMed 28017590