Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

p-mCherry-C1-PsACR1
(Plasmid #85465)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 85465 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone size w/o insert (bp) 4703
  • Total vector size (bp) 5576
  • Modifications to backbone
    EGFP has been replaced by mCherry using AgeI/XhoI (XhoI site destroyed during cloning)
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Synthetic construct PsChR1 gene
  • Alt name
    PsACR1
  • Species
    Synthetic; Proteomonas sulcata
  • Insert Size (bp)
    873
  • GenBank ID
    KF992074.1
  • Promoter CMV (+enhancer)
  • Tag / Fusion Protein
    • mCherry (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (unknown if destroyed)
  • 3′ cloning site AgeI (unknown if destroyed)
  • 5′ sequencing primer EGFP-N1-F: GAGGTCTATATAAGCAGAGC or CMV-F: GCAAATGGGCGGTAGGCGT
  • 3′ sequencing primer EGFP-C1-R: AACCATTATAAGCTGCAATAAAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p-mCherry-C1-PsACR1 was a gift from Peter Hegemann (Addgene plasmid # 85465 ; http://n2t.net/addgene:85465 ; RRID:Addgene_85465)
  • For your References section:

    Identification of a Natural Green Light Absorbing Chloride Conducting Channelrhodopsin from Proteomonas sulcata. Wietek J, Broser M, Krause BS, Hegemann P. J Biol Chem. 2016 Feb 19;291(8):4121-7. doi: 10.1074/jbc.M115.699637. Epub 2016 Jan 6. 10.1074/jbc.M115.699637 PubMed 26740624