Skip to main content

p-mCherry-C1-PsACR1
(Plasmid #85465)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 85465 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 85465-D50 50 μg of DNA in Tris buffer $495
DNA 85465-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone size w/o insert (bp) 4703
  • Total vector size (bp) 5576
  • Modifications to backbone
    EGFP has been replaced by mCherry using AgeI/XhoI (XhoI site destroyed during cloning)
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Synthetic construct PsChR1 gene
  • Alt name
    PsACR1
  • Species
    Synthetic; Proteomonas sulcata
  • Insert Size (bp)
    873
  • GenBank ID
    KF992074.1
  • Promoter CMV (+enhancer)
  • Tag / Fusion Protein
    • mCherry (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (unknown if destroyed)
  • 3′ cloning site AgeI (unknown if destroyed)
  • 5′ sequencing primer EGFP-N1-F: GAGGTCTATATAAGCAGAGC or CMV-F: GCAAATGGGCGGTAGGCGT
  • 3′ sequencing primer EGFP-C1-R: AACCATTATAAGCTGCAATAAAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p-mCherry-C1-PsACR1 was a gift from Peter Hegemann (Addgene plasmid # 85465 ; http://n2t.net/addgene:85465 ; RRID:Addgene_85465)
  • For your References section:

    Identification of a Natural Green Light Absorbing Chloride Conducting Channelrhodopsin from Proteomonas sulcata. Wietek J, Broser M, Krause BS, Hegemann P. J Biol Chem. 2016 Feb 19;291(8):4121-7. doi: 10.1074/jbc.M115.699637. Epub 2016 Jan 6. 10.1074/jbc.M115.699637 PubMed 26740624