Skip to main content

RhGC(BE)_pGEM
(Plasmid #85469)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 85469 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 85469-D50 50 μg of DNA in Tris buffer $495
DNA 85469-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pGEM
  • Backbone size w/o insert (bp) 3045
  • Total vector size (bp) 4923
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    rhodopsin-guanylyl cyclase
  • Alt name
    RhGC(BE)
  • Alt name
    RhGC
  • Species
    Synthetic; Blastocladiella emersonii
  • Insert Size (bp)
    1878
  • GenBank ID
    KP731361.1
  • Promoter T7 Promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site HindIII (unknown if destroyed)
  • 5′ sequencing primer T7 forward
  • 3′ sequencing primer Seq12rv: GTGTAAGTTGGTATTATGTAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    RhGC(BE)_pGEM was a gift from Peter Hegemann (Addgene plasmid # 85469 ; http://n2t.net/addgene:85469 ; RRID:Addgene_85469)
  • For your References section:

    The rhodopsin-guanylyl cyclase of the aquatic fungus Blastocladiella emersonii enables fast optical control of cGMP signaling. Scheib U, Stehfest K, Gee CE, Korschen HG, Fudim R, Oertner TG, Hegemann P. Sci Signal. 2015 Aug 11;8(389):rs8. doi: 10.1126/scisignal.aab0611. 10.1126/scisignal.aab0611 PubMed 26268609