RhGC(BE)_pGEM
(Plasmid
#85469)
-
PurposeThe rhodopsin-guanylyl cyclase of the aquatic fungus Blastocladiella emersonii enables fast optical control of cGMP signaling
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 85469 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGEM
- Backbone size w/o insert (bp) 3045
- Total vector size (bp) 4923
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namerhodopsin-guanylyl cyclase
-
Alt nameRhGC(BE)
-
Alt nameRhGC
-
SpeciesSynthetic; Blastocladiella emersonii
-
Insert Size (bp)1878
-
GenBank IDKP731361.1
- Promoter T7 Promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site HindIII (unknown if destroyed)
- 5′ sequencing primer T7 forward
- 3′ sequencing primer Seq12rv: GTGTAAGTTGGTATTATGTAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
RhGC(BE)_pGEM was a gift from Peter Hegemann (Addgene plasmid # 85469 ; http://n2t.net/addgene:85469 ; RRID:Addgene_85469) -
For your References section:
The rhodopsin-guanylyl cyclase of the aquatic fungus Blastocladiella emersonii enables fast optical control of cGMP signaling. Scheib U, Stehfest K, Gee CE, Korschen HG, Fudim R, Oertner TG, Hegemann P. Sci Signal. 2015 Aug 11;8(389):rs8. doi: 10.1126/scisignal.aab0611. 10.1126/scisignal.aab0611 PubMed 26268609