Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #85469)


Item Catalog # Description Quantity Price (USD)
Plasmid 85469 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 3045
  • Total vector size (bp) 4923
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    rhodopsin-guanylyl cyclase
  • Alt name
  • Alt name
  • Species
    Synthetic; Blastocladiella emersonii
  • Insert Size (bp)
  • GenBank ID
  • Promoter T7 Promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site HindIII (unknown if destroyed)
  • 5′ sequencing primer T7 forward
  • 3′ sequencing primer Seq12rv: GTGTAAGTTGGTATTATGTAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    RhGC(BE)_pGEM was a gift from Peter Hegemann (Addgene plasmid # 85469 ; ; RRID:Addgene_85469)
  • For your References section:

    The rhodopsin-guanylyl cyclase of the aquatic fungus Blastocladiella emersonii enables fast optical control of cGMP signaling. Scheib U, Stehfest K, Gee CE, Korschen HG, Fudim R, Oertner TG, Hegemann P. Sci Signal. 2015 Aug 11;8(389):rs8. doi: 10.1126/scisignal.aab0611. 10.1126/scisignal.aab0611 PubMed 26268609