-
PurposeMachinery plasmid expressing permissive pCNF synthetase and cognate amber suppressing tRNA. Incorporates azidoPhenylalanine.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 85495 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepDule2
- Backbone size w/o insert (bp) 5400
- Total vector size (bp) 6300
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namepara-cyanophenylalanine Mj synthetase
-
Alt namepCNF
-
Alt namepCNPhe
-
Alt namep-azidoPhe synthetase
-
SpeciesMethanocaldococcus jannaschii
-
Insert Size (bp)921
-
MutationY32L L65V F108W Q109M D158G I159P
- Promoter lpp (constitutive)
-
Tag
/ Fusion Protein
- None
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer CGTCACTGCGTCTTTTACTG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDule2-pCNF was a gift from Ryan Mehl (Addgene plasmid # 85495 ; http://n2t.net/addgene:85495 ; RRID:Addgene_85495) -
For your References section:
Probing protein folding using site-specifically encoded unnatural amino acids as FRET donors with tryptophan. Miyake-Stoner SJ, Miller AM, Hammill JT, Peeler JC, Hess KR, Mehl RA, Brewer SH. Biochemistry. 2009 Jun 30;48(25):5953-62. doi: 10.1021/bi900426d. 10.1021/bi900426d PubMed 19492814