Skip to main content
Addgene

pDule2-3-nitroTyrosine (5B)
(Plasmid #85499)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 85499 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pDule2
  • Backbone size w/o insert (bp) 5400
  • Total vector size (bp) 6300
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    3-nitroTyrosine tRNA synthetase and cognate amber suppressing tRNA derived from M. jannaschii Tyrosine synthetase/tRNA system
  • Alt name
    3NY (5B) synthetase
  • Alt name
    3-nitroY (5B) synthetase
  • Alt name
    3-nitroTyr (5B) synthetase
  • Species
    Methanocaldococcus jannaschii
  • Insert Size (bp)
    921
  • Mutation
    Y32H H70C D158S I159A L162R
  • Promoter lpp (constitutive)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer CGTCACTGCGTCTTTTACTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDule2-3-nitroTyrosine (5B) was a gift from Ryan Mehl (Addgene plasmid # 85499 ; http://n2t.net/addgene:85499 ; RRID:Addgene_85499)
  • For your References section:

    Structural basis of improved second-generation 3-nitro-tyrosine tRNA synthetases. Cooley RB, Feldman JL, Driggers CM, Bundy TA, Stokes AL, Karplus PA, Mehl RA. Biochemistry. 2014 Apr 1;53(12):1916-24. doi: 10.1021/bi5001239. Epub 2014 Mar 20. 10.1021/bi5001239 PubMed 24611875