pDule2-IBBN (G2)
(Plasmid
#85501)
-
PurposePlasmid for incorporating the non-canonical amino acid IBBN with the Mj IBBN (G2) synthetase and cognate amber suppressing tRNA in Ecoli.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 85501 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepDule2
- Backbone size w/o insert (bp) 5400
- Total vector size (bp) 6300
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameIBBN (G2) synthetase and cognate amber suppressing tRNA derived from M. jannaschii Tyrosine synthetase/tRNA system
-
Alt nameIBBA (G2) synthetase
-
Alt nameBibaf (G2) synthetase
-
SpeciesMethanocaldococcus jannaschii
-
Insert Size (bp)921
-
MutationY32G L65E F108W Q109M D158S R162K
- Promoter lpp (constitutive)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer CGTCACTGCGTCTTTTACTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This synthetase is permissive and can incorporate a variety of amino acids structurally analogous to IBBN. For a more complete functional and structural analysis of this synthetase, also see Cooley et al. Chembiochem. 2014, 15(12): 1810–1819.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDule2-IBBN (G2) was a gift from Ryan Mehl (Addgene plasmid # 85501 ; http://n2t.net/addgene:85501 ; RRID:Addgene_85501) -
For your References section:
Genetically encoded initiator for polymer growth from proteins. Peeler JC, Woodman BF, Averick S, Miyake-Stoner SJ, Stokes AL, Hess KR, Matyjaszewski K, Mehl RA. J Am Chem Soc. 2010 Oct 6;132(39):13575-7. doi: 10.1021/ja104493d. 10.1021/ja104493d PubMed 20839808