Skip to main content

FgH1tUTG_hup53_Ex4
(Plasmid #85538)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 85538 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    FUGW
  • Backbone manufacturer
    David Baltimore
  • Total vector size (bp) 10957
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    hup53 Ex4
  • gRNA/shRNA sequence
    TCCCGGCAGCTACGGTTTCCGTCT
  • Species
    H. sapiens (human)
  • Promoter H1t

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmB1 (destroyed during cloning)
  • 3′ cloning site BsmB1 (destroyed during cloning)
  • 5′ sequencing primer CAGACATACAAACTAAAGAAT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    FgH1tUTG_hup53_Ex4 was a gift from Marco Herold (Addgene plasmid # 85538 ; http://n2t.net/addgene:85538 ; RRID:Addgene_85538)