pJYS3_ΔcrtYf
(Plasmid #85542)

• Purpose: Constitutive transcription of FnCpf1 and crRNA of crtYf
• Depositing Lab: Sheng Yang
• Publication: Jiang et al Nat Commun. 2017 May 4;8:15179. doi: 10.1038/ncomms15179.

Backbone

• Vector backbone: pXMJ19
• Backbone size w/o insert (bp): 5600
• Vector type: Bacterial Expression, CRISPR ; Shuttle vector Corynebacterium glutamicum / E. coli

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: Cpf1
• Species: Francisella tularensis subsp. novicida

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: M13pUC-Rev

Gene/Insert 2

• Gene/Insert name: crRNA of crtYf
• Alt name: crRNA: gaatttctactgttgtagatcaggcaaccatagggcaggaa
• Species: Synthetic

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: unknown
• 3′ sequencing primer: pBAD-R

Resource Information

• Supplemental Documents:
  • Annotated GenBank File

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry