FUCas9GFP
(Plasmid
#85555)
-
PurposeExpresses Cas9 with green fluorescent reporter
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 85555 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneFUGW
-
Backbone manufacturerDavid Baltimore
- Total vector size (bp) 14263
-
Vector typeMammalian Expression, Lentiviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehumanised S.pyogenes Cas9
-
SpeciesS.pyogenes
-
Insert Size (bp)4290
- Promoter hUBC
-
Tag
/ Fusion Protein
- Flag
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoR1 (not destroyed)
- 3′ cloning site BamH1 (not destroyed)
- 5′ sequencing primer ggcgagtgtgttttgtgaag (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FUCas9GFP was a gift from Marco Herold (Addgene plasmid # 85555 ; http://n2t.net/addgene:85555 ; RRID:Addgene_85555)