Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

sgALK(B)
(Plasmid #85563)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 85563 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSpCas9(BB)-2A-Puro (PX459)
  • Backbone manufacturer
    Feng Zhang
  • Total vector size (bp) 9200
  • Modifications to backbone
    Insertion of a sgRNA sequence targeting ALK
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    anaplastic lymphoma receptor tyrosine kinase
  • gRNA/shRNA sequence
    AGAACATTGTTCGCTGCATT
  • Species
    H. sapiens (human)
  • Entrez Gene
    ALK (a.k.a. ALK1, CD246, NBLST3)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer GAGGGCCTATTTCCCATGATTCC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    sgALK(B) was a gift from Luca Grumolato (Addgene plasmid # 85563 ; http://n2t.net/addgene:85563 ; RRID:Addgene_85563)
  • For your References section:

    CRISPR-Barcoding for Intratumor Genetic Heterogeneity Modeling and Functional Analysis of Oncogenic Driver Mutations. Guernet A, Mungamuri SK, Cartier D, Sachidanandam R, Jayaprakash A, Adriouch S, Vezain M, Charbonnier F, Rohkin G, Coutant S, Yao S, Ainani H, Alexandre D, Tournier I, Boyer O, Aaronson SA, Anouar Y, Grumolato L. Mol Cell. 2016 Aug 4;63(3):526-38. doi: 10.1016/j.molcel.2016.06.017. Epub 2016 Jul 21. 10.1016/j.molcel.2016.06.017 PubMed 27453044