Skip to main content
Addgene

pTC-ApoE-Tet
(Plasmid #85578)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 85578 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pT3
  • Backbone size w/o insert (bp) 3392
  • Total vector size (bp) 11193
  • Vector type
    Mammalian Expression, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CreER
  • Insert Size (bp)
    1985
  • Promoter ApoE.HCR.hAAT

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsiWI (unknown if destroyed)
  • 3′ cloning site MluI (unknown if destroyed)
  • 5′ sequencing primer seq intron fwd (TCTCCACAGGTGTCCACTCC)
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    CreER sequence originally from addgene plasmid #12168
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTC-ApoE-Tet was a gift from Ursula Ehmer (Addgene plasmid # 85578 ; http://n2t.net/addgene:85578 ; RRID:Addgene_85578)
  • For your References section:

    An in vivo transfection system for inducible gene expression and gene silencing in murine hepatocytes. Hubner EK, Lechler C, Kohnke-Ertel B, Zmoos AF, Sage J, Schmid RM, Ehmer U. J Gene Med. 2016 Dec 23. doi: 10.1002/jgm.2940. 10.1002/jgm.2940 PubMed 28009940