Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAW019-2
(Plasmid #85614)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 85614 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAX01 (ColE1)
  • Backbone size w/o insert (bp) 7800
  • Total vector size (bp) 12000
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    HI-Control 10G
  • Growth instructions
    Use 0.5 ug/mL erythromycin for cloning in B. subtilis
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    dcas9
  • Species
    S. pyogenes
  • Insert Size (bp)
    4107
  • Promoter PxylA (B. megaterium)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (not destroyed)
  • 3′ cloning site SbfI (not destroyed)
  • 5′ sequencing primer AAGATAGTTGATGGATAAACTTGTTCAC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    pdCas9-bacteria, Stanley Qi

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAW019-2 was a gift from Perry Chou (Addgene plasmid # 85614 ; http://n2t.net/addgene:85614 ; RRID:Addgene_85614)
  • For your References section:

    Development of a CRISPR-Cas9 toolkit for comprehensive engineering of Bacillus subtilis. Westbrook AW, Moo-Young M, Chou CP. Appl Environ Microbiol. 2016 Jun 3. pii: AEM.01159-16. 10.1128/AEM.01159-16 PubMed 27260361