Skip to main content

pSH-Csy4-T2A-SaRFN
(Plasmid #85755)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 85755 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSQT-1601
  • Backbone manufacturer
    Shengdar Q Tsai from Keith Joung lab
  • Backbone size w/o insert (bp) 4833
  • Total vector size (bp) 9471
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Csy4-T2A-FokI-SadCas9
  • Alt name
    RNA-guided FokI-nuclease
  • Alt name
    SaRFN
  • Species
    Staphylococcus aureus
  • Insert Size (bp)
    4638
  • Mutation
    D10A, N580A
  • Promoter CAG
  • Tags / Fusion Proteins
    • FokI fusion via 36 amino acid GSAT linker (N terminal on insert)
    • Csy4 (N terminal on backbone)
    • 3xHA tag (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer AGAGCCTCTGCTAACCATGTTC
  • 3′ sequencing primer ttttggcagagggaaaaaga
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    S.a. Cas9 derived from plasmid pX601 (Addgene 61591).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSH-Csy4-T2A-SaRFN was a gift from Lawrence Stanton (Addgene plasmid # 85755 ; http://n2t.net/addgene:85755 ; RRID:Addgene_85755)
  • For your References section:

    Re-engineered RNA-Guided FokI-Nucleases for Improved Genome Editing in Human Cells. Havlicek S, Shen Y, Alpagu Y, Bruntraeger MB, Zufir NB, Phuah ZY, Fu Z, Dunn NR, Stanton LW. Mol Ther. 2017 Feb 1;25(2):342-355. doi: 10.1016/j.ymthe.2016.11.007. 10.1016/j.ymthe.2016.11.007 PubMed 28153087