Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is open for ordering and depositing; find up-to-date details here. To learn more about how we are supporting COVID-19 research and to find related plasmids, check out our COVID-19 and Coronavirus Plasmids & Resources page.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pCLIPf-NK1R Control Plasmid
(Plasmid #101125)


Item Catalog # Description Quantity Price (USD)
Plasmid 101125 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 5235
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418) ; Kanamycin

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    Neurokinin-1 Receptor, Truncated
  • Alt name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Entrez Gene
    TACR1 (a.k.a. NK1R, NKIR, SPR, TAC1R)
  • Promoter CMV
  • Tags / Fusion Proteins
    • 10xHis (C terminal on backbone)
    • CLIP-tag (CLIPf) (N terminal on backbone)
    • FLAG Epitope (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer ATCCCCTGCCACCGGGTGGT (SNAP/CLIP Forward Primer)
  • 3′ sequencing primer CTGGGGCAGGCACTTCCA (SNAP/CLIP Reverse Primer)
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry

Depositor Comments

Originally cloned by Covalys. The truncated NK1R is an N-terminal insert. The Flag Epitope is a C-insert. The vector is also resistant to Kanamycin.

For more information on this plasmid, please see

This plasmid is covered by one or more patents, trademarks and/or copyrights owned or controlled by New England Biolabs, Inc (NEB). For more information about commercial rights, please contact NEB's Global Business Development team at [email protected].

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCLIPf-NK1R Control Plasmid was a gift from New England Biolabs & Ana Egana (Addgene plasmid # 101125 ; ; RRID:Addgene_101125)