-
PurposeExpression of SNAP-tagged Histone H2B in mammalian cells
-
Depositing Labs
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 101124 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * | |
* Log in to view industry pricing.
Backbone
-
Vector backbonepSNAP
- Backbone size w/o insert (bp) 5858
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418) ; Kanamycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehistone cluster 1 H2B family member j
-
SpeciesH. sapiens (human)
-
Insert Size (bp)378
-
Entrez GeneH2BC11 (a.k.a. H2B/r, H2BFR, H2BJ, HIST1H2BJ)
- Promoter CMV
-
Tag
/ Fusion Protein
- SNAP-tag (SNAPf) (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer GACGCAAATGGGCGGTAG (CMV Forward Primer)
- 3′ sequencing primer AGGGAGTACTCACCCCAACA (ST1 Reverse Primer)
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Originally cloned at New England Biolabs. The H2B insert is a N-terminal insert.
This plasmid is covered by one or more patents, trademarks and/or copyrights owned or controlled by New England Biolabs, Inc (NEB). For more information about commercial rights, please contact NEB's Global Business Development team at [email protected]. For more information on this plasmid, please see https://www.addgene.org/depositor-collections/neb-cell-imaging-tags/
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSNAPf-H2B Control Plasmid was a gift from New England Biolabs & Ana Egana (Addgene plasmid # 101124 ; http://n2t.net/addgene:101124 ; RRID:Addgene_101124)