-
PurposeCRISPR/Cas9 in Arabidopsis with seed a fluorescent reporter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 85758 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepFAST-R01
-
Backbone manufacturerProf. Ikuko Hara-Nishimura
- Total vector size (bp) 18518
-
Modifications to backboneAtU6.26p::AarIx2:sgRNA is inserted.
-
Vector typePlant Expression, CRISPR
-
Selectable markersHygromycin ; TagRFP in seeds
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namehuman-codon-optimized SpCas9
-
SpeciesStreptococcus pyogenes
-
Insert Size (bp)4101
- Promoter AtRPS5A
-
Tag
/ Fusion Protein
- FLAG (N terminal on insert)
Cloning Information
- Cloning method TOPO Cloning
- 5′ sequencing primer atggactataaggaccacgac
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byhuman-codon-optimized SpCas9 was closed from pX330-U6-Chimeric_BB-CBh-hSpCas9 (item #42230) that we bought from Addgene on 6th June, 2013 by Prof. Tetsuya Higashiyama
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Right border (RB) may be truncated in the T-DNA integration. This may result in sgRNA scaffold truncation because the RB is close to 3' end of sgRNA. However, since we efficiently obtained knockout mutants by this vector, the truncation is not serious problem.
To overcome it, we also deposited pKI1.1R. In pKI1.1R, sgRNA is not close to RB.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKIR1.1 was a gift from Tetsuya Higashiyama (Addgene plasmid # 85758 ; http://n2t.net/addgene:85758 ; RRID:Addgene_85758) -
For your References section:
pKAMA-ITACHI vectors for highly efficient CRISPR/Cas9-mediated gene knockout in Arabidopsis thaliana. Tsutsui H, Higashiyama T. Plant Cell Physiol. 2016 Nov 17. pii: pcw191. 10.1093/pcp/pcw191 PubMed 27856772