-
Purpose(Empty Backbone) Backbone for pooled cloning of Perturb-seq libraries
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 85801 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepBA439
-
Backbone manufacturerJonathan Weissman (Addgene #85967)
- Backbone size (bp) 6000
-
Vector typeMammalian Expression, Lentiviral, CRISPR
- Promoter hU6
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer WPRE-R CATAGCGTAAAAGGAGCAACA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPS was a gift from Aviv Regev (Addgene plasmid # 85801 ; http://n2t.net/addgene:85801 ; RRID:Addgene_85801) -
For your References section:
Perturb-Seq: Dissecting Molecular Circuits with Scalable Single-Cell RNA Profiling of Pooled Genetic Screens. Dixit A, Parnas O, Li B, Chen J, Fulco CP, Jerby-Arnon L, Marjanovic ND, Dionne D, Burks T, Raychowdhury R, Adamson B, Norman TM, Lander ES, Weissman JS, Friedman N, Regev A. Cell. 2016 Dec 15;167(7):1853-1866.e17. doi: 10.1016/j.cell.2016.11.038. 10.1016/j.cell.2016.11.038 PubMed 27984732